snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD83
sequence
GCCACATGATGTTCGCTTCTTGAGAAATGAGCGCTTGGCGCAATGCTGACCATTATCTA
TCACCCTGGACTGATGGCT
  Box motif
  Complementary to target RNA
length 78
organism Sorex_araneus
snoRNA name SNORD83
alias
chromosome ⁄ contig GeneScaffold_7064
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved