snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA2
sequence
TCGGCCCTGGATCAAGGCCTGCAGTCGCCGGAGGCTGCCGGTTTCAAGCAGGAGCCCAG
GGAAAGTCTTTCTGTTGTCTGTTGGTCATGTCCGAGTGTCCGTGGTGTGGTCAGTTCATT
AGAAAGAAACAGTC
  Box motif
  Complementary to target RNA
length 133
organism Sorex_araneus
snoRNA name SNORA2
alias
chromosome ⁄ contig scaffold_247852
locus ⁄ host gene Mono:0:SNORA2
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved