snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA73
sequence
CCTATTTTCTCCAGAAACTGTCCAGGTGGCATGGAGGAGCATTTGGATCTGGCTCGTGA
TGTACAATCCCTCTCCCCAGAGTGGGAGATCAAGCCAGGCCTTGAGAGCAAGCCTGCAGA
GCCTGCATCTTCCAACAGCTTCTTAGAATCCTCTGGATGGTGACGGAGGAGACAAACCCT
ATAGGAAACAGTT
  Box motif
  Complementary to target RNA
length 192
organism Sorex_araneus
snoRNA name SNORA73
alias
chromosome ⁄ contig scaffold_231379
locus ⁄ host gene Mono:542:SNORA73
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved