snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA69
sequence
TGAGCAGGTTGCAATTCCAGTGTTTTGTTTTTGTGGGAGTACTGGCATAACCCTGCTGA
AAACAAATCTGTGCCAATCATTTTCTTATTTTACTTTTTTTGGAGGTAAAATTATTGCTG
ATTAGCACAGACAGTT
  Box motif
  Complementary to target RNA
length 135
organism Sorex_araneus
snoRNA name SNORA69
alias
chromosome ⁄ contig GeneScaffold_2253
locus ⁄ host gene Mono:800:SNORA69
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved