snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA24
sequence
CTCCATGTCTCTTTGGGACCTGCTGCCTGTGGCAGCCTCCCTTCCTAACCATGGAAGAG
CAAACCTTGTTGATTGGCAAAGCTGGCACTACGTCGTTGATATCAGGTTCTGACTTGCAC
AAGGGACAGTT
  Box motif
  Complementary to target RNA
length 130
organism Sorex_araneus
snoRNA name SNORA24
alias
chromosome ⁄ contig scaffold_205334
locus ⁄ host gene Mono:402:SNORA24
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved