snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA21
sequence
ACCCTTTTAAAGGCACTTATTGGGCCTTTTGCTAGTGACCCACTGAGCCGTCGACAAAG
GACAGTGTAAAGATATCGCTTTTGGGTGAAGCAGCCACATGTTGTGTTGTTTGGCTTCAG
TCAGCGGTGTAACAACG
  Box motif
  Complementary to target RNA
length 136
organism Sorex_araneus
snoRNA name SNORA21
alias
chromosome ⁄ contig scaffold_249726
locus ⁄ host gene Mono:508:SNORA21
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved