snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD26
sequence
CTGCGGGGATGATTCTGACCCTTGAACTCTCTCTTGCTGATGGGCCAGTGGAGAAAAAT
CCTCAAAGTTCTGAGTGGC
  Box motif
  Complementary to target RNA
length 78
organism Sorex_araneus
snoRNA name SNORD26
alias
chromosome ⁄ contig scaffold_150444
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved