snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD22
sequence
TCCCCATGAAGAAACTCTCACATGTCTTACCACCTGTCCTAGTCCCAGAGCCTGCAAAG
GTGAACCCACTGGGACTGGCTGGGGGAAAAGAGGCAAGCTTGTTCCAGCAGGAACTGTCT
GAGGGAT
  Box motif
  Complementary to target RNA
length 126
organism Sorex_araneus
snoRNA name SNORD22
alias
chromosome ⁄ contig scaffold_206585
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved