snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA22
sequence
CTGCACAGTGAACACCCAAGTGTTCTTTATAGTTCCCTTGGTTTTAACTCTGTGCTAGA
GCAATATCTGTTCTTTACCTCCGTATTGACAGGACTATCCTTTTAAGTGTATTCAGAAAG
TCAGCACATTA
  Box motif
  Complementary to target RNA
length 130
organism Sorex_araneus
snoRNA name SNORA22
alias
chromosome ⁄ contig scaffold_245553
locus ⁄ host gene
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved