snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD77
sequence
ATACGATGATGGTTGCATAGTTCAGCAGATTGGCTGTGAAGAGATGAACCAATGTCTGA
TGTATCT
  Box motif
  Complementary to target RNA
length 66
organism Sorex_araneus
snoRNA name SNORD77
alias
chromosome ⁄ contig scaffold_110579
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved