snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snR99
sequence
CCATCATCAGTAGGTTTTAACTTACTTTGTTATATAAGTAAAGTAAAATCAATCCTGAA
GTCAAGTATGATGGTTGGAGTCTCCGGACCAAGAAAATGCATCCGTTCCGTCTTCAGCGA
AGAATTGAGTGGCTTTCCCGGTCGTTGACTTTTTTCCATGGGTCAAGGATGGGATTGTCT
CCCAGACATTT
  Box motif
  Complementary to target RNA
length 190
organism Schizosaccharomyces_pombe
snoRNA name snR99
alias
chromosome ⁄ contig III
locus ⁄ host gene Mono:sno12
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved