snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snu32
sequence
ATCGACGATACTCCATAGGATCATTTCTATAGTATACGTCCGGCTTGGGTTTCCTAACC
TAGCCACAGAACTCAACACGGATGATGATAGAAGGCACCGTTGCCCGCAGAGTGAGAATT
TTTACTTCTTTGAGGATGTGCTGATCGATTTGGCTTTTTGCTTAATTGTTGTGCTATCTT
TATTTGCGATGATCTCTTACATGATATGTTCCTTTTGGTCGTGTCATGTAGGGCAGCTGG
TGTTTTCTGACGTGTT
  Box motif
  Complementary to target RNA
length 255
organism Schizosaccharomyces_pombe
snoRNA name snu32
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:snu32
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved