snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snoR68
sequence
GCATATGATGAGAACATATATTTTTATCTGAAAAAAATTGTTGAATAAAAATTTATGCG
TTATCTTTCTGATG
  Box motif
  Complementary to target RNA
length 73
organism Schizosaccharomyces_pombe
snoRNA name snoR68
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:snoR68
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved