snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snoR61
sequence
CCAACAAAACATTTAGTTTCGTTGTGCTGGTGATATCGCACAAGTTAAGTGAAAAGGGA
TATTTTGCTTAACTTGCTACGATATTGCTAGTTAGATATCTTTTTGAATGATTAATTGAT
TTTAGCTGTTTTTTACCGAAGCATTTACTAAAGCCATTTACATGTATGATGATACTTAAT
TTTCAGTTCTGCTTCTGAGAAAAGCTTGAAGACAACCTGATACCAAGAAACTCTCTATTA
TCTGATTGTGTTAATAGGCTTACTGCATTTGCTTGTGTTTTGAAATAGATAAATCAAATA
TATATGTTCGTGTATTAA
  Box motif
  Complementary to target RNA
length 317
organism Schizosaccharomyces_pombe
snoRNA name snoR61
alias
chromosome ⁄ contig II
locus ⁄ host gene Poly:snoR61
organization Mono
target RNA
modification type
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved