snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snoU18
sequence
AGCTATGATGACCAAAATTGGTCCGTGTTACTGAGCGGGATTAAGACCCCAGCAAACGA
AGAGAAACCCAATTTTTAATTCTGATT
  Box motif
  Complementary to target RNA
length 86
organism Schizosaccharomyces_pombe
snoRNA name snoU18
alias
chromosome ⁄ contig II
locus ⁄ host gene ero11
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved