snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snoR39b
sequence
CAAGATGATGACAACAAATTTCGGATAGCTAGCTTAGGCTGTGCGCGTTCCACAATTTA
CCATCTTTCGGGACTGATT
  Box motif
  Complementary to target RNA
length 78
organism Schizosaccharomyces_pombe
snoRNA name snoR39b
alias
chromosome ⁄ contig II
locus ⁄ host gene rpl701
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved