snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snoR58
sequence
GCCTATGATGATTACCGTTTATTTAGATGCTAGACTTCTGAATTTCATCTTATGTAGCT
ACAAGGTTTTCTGAGG
  Box motif
  Complementary to target RNA
length 75
organism Schizosaccharomyces_pombe
snoRNA name snoR58
alias
chromosome ⁄ contig I
locus ⁄ host gene ade4
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved