snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snr62
sequence
CAAAGTGATGTGAAAAAAATTCTTATCTACATTGCCTGAATCATATAGATGAAAAACTA
TCTTGTTTACTGATT
  Box motif
  Complementary to target RNA
length 74
organism Schizosaccharomyces_pombe
snoRNA name snr62
alias
chromosome ⁄ contig I
locus ⁄ host gene SPAC4H3.12c
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved