snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snR191
sequence
ATGCCACATACATAGCACGATTGGAGGCTTTGGAATTTGAGTCTCGGTGAATCAAAGTT
CTTTGGTCTTGTGAATCCACGTGCAACTAAAAGGAGTGCTAACAGTGACTTTTGGTACGC
TGTGTATATGCAGAAAAAGATATTAGACACCAATTAAGCCGGGACGAAAGCCTAATTGGA
TTGCTTTCGTCTGACTATGCGTGTTTTACATTC
  Box motif
  Complementary to target RNA
length 212
organism Schizosaccharomyces_pombe
snoRNA name snR191
alias
chromosome ⁄ contig I
locus ⁄ host gene SPAC6F6.03c
organization Intronic
target RNA
modification type
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved