snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snR41
sequence
CATTGTGATGATAAAACGACGAAAACAGCTGAATTCCTCATGTTGAATTCGTTATATTA
TTTTTTAAGTTTCAGCCTTGTCTGATC
  Box motif
  Complementary to target RNA
length 86
organism Schizosaccharomyces_pombe
snoRNA name snR41
alias
chromosome ⁄ contig I
locus ⁄ host gene Poly:snR41
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved