snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snu3
sequence
AATTCTTTGAAGGCATGCTTTTCGATTAGGTTTTTTACCTAATTGTTTTGCTGTCTTTC
TATGCGATGATCTCTTACATGATATGTTTCCTTTTGGTCGTATTATGTAGGGCAGCTGGT
GTTTTCTGACGTGTTTAATTTCATCTATTATATTACAACTGTGGTGTCGTTTGATGACAT
AGATGTAATTTCTAGATGAAGTTGTGTCATGTTTTAGCGTAGATTTTAGTGAATAAATGA
AACGATTTCAAATTCCG
  Box motif
  Complementary to target RNA
length 256
organism Schizosaccharomyces_pombe
snoRNA name snu3
alias
chromosome ⁄ contig I
locus ⁄ host gene Mono:snu3
organization Mono
target RNA
modification type
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved