snOPY snoRNA Orthological Gene Database
Schizosaccharomyces_pombe snoZ8
sequence
ATCTTTGATGACCATTTTTTAAAATACAAACTAGAGTTTCTGATTAATTTATGATTTCA
AATTCTTGCTGAGTTTAGT
  Box motif
  Complementary to target RNA
length 78
organism Schizosaccharomyces_pombe
snoRNA name snoZ8
alias
chromosome ⁄ contig I
locus ⁄ host gene psf3-antisense-1
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved