snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR45
sequence
AATGACCTTCCAAGTTTTTAAAAGAATACGATGATATTATTTGCGTTTCAAATCGAACA
ATTCTTCTCGGAGCGATCTGAGGTTTTAATGGAGATAGCGGTTCCTGCGCAACCCATTGA
TCTTGTTACATTCTTAAGAATGACAAGGACGCTTTTATAAAATTCTGATTCTT
  Box motif
  Complementary to target RNA
length 172
organism Saccharomyces_cerevisiae
snoRNA name snR45
alias
chromosome ⁄ contig 16
locus ⁄ host gene
organization Mono
target RNA Unknown
modification type C/D
modification site
accession no U56646,BK006949
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved