snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR59
sequence
CTTAATGATGAAAACTATTCCTTATTCTCGACTAGTCTTTGACAATGCTGTCGTTTAAT
CACCATCTTTCGGCTGACT
  Box motif
  Complementary to target RNA
length 78
organism Saccharomyces_cerevisiae
snoRNA name snR59
alias
chromosome ⁄ contig XVI
locus ⁄ host gene RPL7B
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:A807
accession no AF064271,BK006949
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved