snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae U3a
sequence
GTCGACGTACTTCATAGGATCATTTCTATAGGAATCGTCACTCTTTGACTCTTCAAAAG
AGCCACTGAATCCAACTTGGTTGATGAGTCCCATAACCTTTGTACCCCAGAGTGAGAAAC
CGAAATTGAATCTAAATTAGCTTGGTCCGCAATCCTTAGCGGTTCGGCCATCTATAATTT
TGAATAAAAATTTTGCTTTGGCGTTGCATTTGTAGTTTTTTCCTTTGGAAGTAATTACAA
TATTTTATGGCGCGATGATCTTGACCCATCCTATGTACTTCTTTTTTGAAGGGATAGGGC
TCTATGGGTGGGTACAAATGGCAGTCTGACAAGT
  Box motif
  Complementary to target RNA
length 333
organism Saccharomyces_cerevisiae
snoRNA name U3a
alias snR17a
chromosome ⁄ contig XV
locus ⁄ host gene Mono:48:U3a
organization Mono
target RNA 18S rRNA
modification type C/D
modification site Cleavage of rRNA
accession no M26648,BK006948
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved