snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR191
sequence
TACCAAACCTTTTTGTCAGGGTGCTTCTCTATCCGTTTTAGGATAAACTTATCTACAGA
AGTGTCTGTTACTGTTTTGGAAGAGTAATACTGTTCGCTTATCCATATTTCCCCGTTCTG
GGGAAGCCTCATGGGTAAATTAGAAGGACAACCTTTGTTTTAAAGGTATACCTTCGCTTT
TTAGAACAGCGAGGATCTTATGAGTTGAGCTTTTGTTATTTGAGACTTTATCTCGGGCTC
CATACAATATGTTCGTAGTAAAGATCCTCACAATT
  Box motif
  Complementary to target RNA
length 274
organism Saccharomyces_cerevisiae
snoRNA name snR191
alias
chromosome ⁄ contig XIV
locus ⁄ host gene NOG2
organization Intronic
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2258,25S:U2260
accession no BK006947
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved