snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR54
sequence
TAAGATGATGATCAACTTTTTATATCAATAACTTTCGTTCTACTGACTGTGATCAAACG
ATCTTGTAGAGAACTTTTACTCTGAAT
  Box motif
  Complementary to target RNA
length 86
organism Saccharomyces_cerevisiae
snoRNA name snR54
alias
chromosome ⁄ contig XIII
locus ⁄ host gene IMD4
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A974
accession no AF064266,BK006946
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved