snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR44
sequence
CTCCGGGCTGATAACTAGATGGTGTGATCGGGCAGTATACTAATTTATACTGGACAAAG
ACTCGTAAAAGATGTTCTTTGTGCTTAGTCCCATACTGTTTTTTAAGTGTCCGGGATATT
TAATCCCATGTGGAAATGCTTCTTACACGGTTATGGATTACACCTCATGTGTAGCTACTA
TATCCATTACCGTTTACTTTTCCTCAAAATCT
  Box motif
  Complementary to target RNA
length 211
organism Saccharomyces_cerevisiae
snoRNA name snR44
alias
chromosome ⁄ contig XII
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 18S:U106,25S:U1056
accession no U56645,BK006945
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved