snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR38
sequence
CATAATGATGAAAAAAAATTTTATCAAACAGTTATCCCTGTCTGAATGGGTAATAATAG
GTAACCTCTCATATGTTGATATTTGTATTTCTGATA
  Box motif
  Complementary to target RNA
length 95
organism Saccharomyces_cerevisiae
snoRNA name snR38
alias
chromosome ⁄ contig XI
locus ⁄ host gene TEF4
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:G2815
accession no U26012,BK006944
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved