snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR39
sequence
TTTTATGATGAAAATCCATTGTATCCCAATACATATTCGACTAGTCATTGACGATGCTG
TCGTAACTTATCACCATCTTTCGACTGATT
  Box motif
  Complementary to target RNA
length 89
organism Saccharomyces_cerevisiae
snoRNA name snR39
alias
chromosome ⁄ contig VII
locus ⁄ host gene RPL7A
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:A807
accession no U26011,BK006941
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved