snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae U18
sequence
GTGAATGATGAATTTAATTCTTTGGTCCGTGTTTATGATGGGAAGTAAGACCCCCGATA
TGAGTGACAAAAGAGATGTGGTTGACTATCACAGTATCTGACG
  Box motif
  Complementary to target RNA
length 102
organism Saccharomyces_cerevisiae
snoRNA name U18
alias snR18
chromosome ⁄ contig I
locus ⁄ host gene EFB1
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:A649,25S:C650
accession no U12981,BK006935
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved