snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR62
sequence
TTTTATGATGAATTTATGTTTTCAATCTTATCTACATTATCTGAATTAATAGCTAACAA
TAGTTATAATGGAAGATATACGACTATCAACAATTCTGAAA
  Box motif
  Complementary to target RNA
length 100
organism Saccharomyces_cerevisiae
snoRNA name snR62
alias
chromosome ⁄ contig XV
locus ⁄ host gene Mono:46:snR62
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:U1888
accession no AF064274,BK006948
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved