snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR9
sequence
GGGAATATAATACTAAATACTCTGTTATATAGAACTTTCTACGCCTTTTCCTCTATGGC
TATGAAAGCGTGGACAACGGAGACAAATAGACCAATTACTGAATATGGCTTTTGACATAT
CTTCTTCTTCATGGGTGAGGATTAAGCTGATATCCTGACCCACCTATCATTAGTCCTTCA
GACATACT
  Box motif
  Complementary to target RNA
length 187
organism Saccharomyces_cerevisiae
snoRNA name snR9
alias
chromosome ⁄ contig XV
locus ⁄ host gene Mono:47:snR9
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2340
accession no M20765,BK006948
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved