snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR5
sequence
ATCATTCAATAAACTGATCTTCCGGATTACCATGCTTAAGACATCACGCCTCCATATGT
CTATATAAAGCGCAAATGGCTGGAAGTAGACCAATTTTTTTTGTTCCTAGCTTTTCATTA
TTGAAATCTAATCCAGTTTTAATGGTTTTTCTTAATTAAGAAAACAAATTATCATTGGTT
CGCTCTAGGTGTACATATCTTCACT
  Box motif
  Complementary to target RNA
length 204
organism Saccharomyces_cerevisiae
snoRNA name snR5
alias
chromosome ⁄ contig XV
locus ⁄ host gene Mono:44:snR5
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U1004,25S:U1124
accession no M20763,BK006948
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved