snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR66
sequence
ATCAAATGATGAAATACCAATGCAACAGAGTCAAGCTCTGAGTTTCAAAAAGAAACATG
GACGAGATTGCTTTTTTATTACTGACC
  Box motif
  Complementary to target RNA
length 86
organism Saccharomyces_cerevisiae
snoRNA name snR66
alias Z16
chromosome ⁄ contig XIV
locus ⁄ host gene Mono:50:snR66
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:U2417
accession no AF064278,BK006947
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved