snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae MRP
sequence
AATCCATGACCAAAGAATCGTCACAAATCGAAGCTTACAAAATGGAGTAAAATTTTTTT
TACTCAGTAATATGCTTTGGGTTGAAAGTCTCCCACCAATTCGTATGCGGAAAACGTAAT
GAGATTTAAAAATTTTAAATTGTTTAAATCAACTCATTAAGGAGGATGCCCTTGGGTATT
CTGCTTCTTGACCTGGTACCTCTATTGCAGGGTACTGGTGTTTTCTTCGGTACTGGATTC
CGTTTGTATGGAATCTAAACCATAGTTATGACGATTGCTCTTTCCCGTGCTGGATCGAGT
AACCCAATGGAGCTTACTATTCTTGGTCCATGGATTCACCC
  Box motif
  Complementary to target RNA
length 340
organism Saccharomyces_cerevisiae
snoRNA name MRP
alias NME1,RRP2
chromosome ⁄ contig XIV
locus ⁄ host gene Mono:50:MRP
organization Mono
target RNA Unknown
modification type unknown
modification site Processing
accession no BK006947
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved