snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR41
sequence
TCCCCTATGATTAAAAATTATTAATCATATACCAATTGTTCCGACTGAATAGTGGTTTA
ACTACATGTCGACAACCCTTTTTCGTTAAGTTTCAGCCTTGTATGAGGGGT
  Box motif
  Complementary to target RNA
length 110
organism Saccharomyces_cerevisiae
snoRNA name snR41
alias
chromosome ⁄ contig XVI
locus ⁄ host gene Poly:6:snR51
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:A541,18S:G1126
accession no U26016,BK006949
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved