snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR51
sequence
TATTATGATGATTTTTTTATATTCACACTGTACTAGATTGGTCTCTTTAACGAAGGGGC
TAATTGATGACTACAAAATAAAAAATAACTGATTTAATGACTCTGAAA
  Box motif
  Complementary to target RNA
length 107
organism Saccharomyces_cerevisiae
snoRNA name snR51
alias
chromosome ⁄ contig XVI
locus ⁄ host gene Poly:6:snR51
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:A100,25S:U2729
accession no AF064263,BK006949
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved