snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR87
sequence
GTAACTGAATGATGATATAATTTGCGATCTAGGGCTAATCACTTGGAACACCGCCATGT
TCTATATGGGTGATTAGCGAAGTGCGAAAAATTTTTTATCTGATATTTTC
  Box motif
  Complementary to target RNA
length 109
organism Saccharomyces_cerevisiae
snoRNA name snR87
alias
chromosome ⁄ contig XI
locus ⁄ host gene Mono:26:snR87
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:A436
accession no BK006944
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved