snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR40
sequence
GTAAATGACGAGAAAAAAGCTGTGCACCAGTCTGAACATGGATGCCACAAGTACTCAGG
TGTCCTATGAAGCATTAAGTATACCCAAATTTCTGATC
  Box motif
  Complementary to target RNA
length 97
organism Saccharomyces_cerevisiae
snoRNA name snR40
alias
chromosome ⁄ contig XIV
locus ⁄ host gene Mono:35:snR40
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:G1271,25S:U898
accession no U26015,BK006947
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved