snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR190
sequence
GGCCCTGATGATAATGGTGTCTCTTCTTTCCTCGTCCGATTCGACCATGACGACAAGGG
ATTTTATCTCGTTCTCTTAATGCGAATGATTTTGAAAAGATGTTGCTTCTGTGACATTTT
TTTTTAATCATTTGTGTTTGCAAACGGGAACTTTTCTTGCCAGTGTTATACAACACATGC
AGATCTGAGCC
  Box motif
  Complementary to target RNA
length 190
organism Saccharomyces_cerevisiae
snoRNA name snR190
alias
chromosome ⁄ contig X
locus ⁄ host gene Poly:1:snR128
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:G2395
accession no M21124,BK006943
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved