snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR63
sequence
TTTAATGATGAAGATTTTAATTTTCCGTTGGTCTATTAAGAACAGAAGTACTTCAAAAC
TACTTTTTAAGACCATCCTTTTACAGTATTTTTTCAATATTGTAAAACTTCTCATTTACT
TTGTGTCTTTATGATCTCATCGTTCTGGTGGACCATAATCAGACGCACGGTATACTTCGT
TTCTGTTGGAGAATATTGGGAGTCTTTTAATGTGATGAGTGGCCAACATAACCTTATAGT
CATAGTTACACTGATT
  Box motif
  Complementary to target RNA
length 255
organism Saccharomyces_cerevisiae
snoRNA name snR63
alias
chromosome ⁄ contig IV
locus ⁄ host gene Mono:6:snR63
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A2256
accession no AF064275,BK006938
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved