snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR13
sequence
AGGAAGTTTTTTCCTTTTTATATGATGAATATGAGTGCATTTGGCTCGAGTTGCTGTTT
GGCTTTTGCCAAATCAGTAACGGTGTGGAAAAACTCAAGCTACCTTTTTTTACTTTTATC
TGACC
  Box motif
  Complementary to target RNA
length 124
organism Saccharomyces_cerevisiae
snoRNA name snR13
alias
chromosome ⁄ contig IV
locus ⁄ host gene Mono:8:snR13
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A2280,25S:A2281
accession no U16692,BK006938
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved