snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR52
sequence
TACTATGATGAATGACATTAGCGTGAACAATCTCTGATACAAAATCGAAAGATTTTAGG
ATTAGAAAAACTTATGTTGCCTTCCTTCTGAAA
  Box motif
  Complementary to target RNA
length 92
organism Saccharomyces_cerevisiae
snoRNA name snR52
alias Z13
chromosome ⁄ contig V
locus ⁄ host gene Mono:13:snR52
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:A420,25S:U2921
accession no AF064264,BK006939
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved