snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae U3b
sequence
GTCGACGTACTTCATAGGATCATTTCTATAGGAATCGTCACTCTTTGACTCTTCAAAAG
AGCCACTGAATCCAACTTGGTTGATGAGCCCCATAACCTTTGTACCCCAGAGTGAGGAAA
TGAAATCGAATTTAAATTAGCTTGGTCCGCAATCCTTAGCGGTTCGGCCATCTATAATTT
TGAATAAAATTTTGCTTTGCCGTTGCAATTGTGATAACTTCCTTTGGAATTTGTTGCGAT
ATTTAATGGCGCGATGATCTTGACCCATCCTATGTGCTTCCATTTTGGAAGGATAGGGAT
TCATGGGTGGGTACAAATGGCAGTCTGACAAGT
  Box motif
  Complementary to target RNA
length 332
organism Saccharomyces_cerevisiae
snoRNA name U3b
alias snR17b
chromosome ⁄ contig XVI
locus ⁄ host gene Mono:45:snR17b
organization Mono
target RNA 18S rRNA
modification type C/D
modification site Cleavage of rRNA
accession no X05498,BK006949
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved