snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR161
sequence
TAAATATACAACACCCAGTATTTTTGGCTGCCCGTGTCTTTCTCTACCACGGGTAGTCT
CTCTAAGCTGGCAGATAGATGTTTATTGAACCGCTTAAGTTCCGTTGTGAAGTTTTCGTC
TTTCAGGCTGTATTTCATAACACTACTGTAGTTCACACATAC
  Box motif
  Complementary to target RNA
length 161
organism Saccharomyces_cerevisiae
snoRNA name snR161
alias RNA161
chromosome ⁄ contig II
locus ⁄ host gene Mono:1:snR161
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U632,18S:U766
accession no BK006936
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved