snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR11
sequence
AATAATGTCTTTTATAATAGACACCCAGAGTCACGATTCGTCTTGGTTTTAGAGATTCT
GTTTCGACAGTTTTTTTAGGCGGTGGACGTATATAGTTTACTTAATCGTTTACTATACGG
TGGAGTACTAATACTATTTCACTGTCGTGCTCGCGGTTGATCTTAGATAAATATATTTCT
TTTTCATAAAGAAAGTGAGTGGATCTTCCCTGGAAGTACGAATAATGTACTTATGATTAG
ATTCTCTTCACGCACATAC
  Box motif
  Complementary to target RNA
length 258
organism Saccharomyces_cerevisiae
snoRNA name snR11
alias
chromosome ⁄ contig XIII
locus ⁄ host gene Mono:33:snR11
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2416
accession no U16691,BK006946
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved