snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR56
sequence
TTAACATGATGAAAAAATATATTAACACAGACCTGTACTGAACTTTTCGAAGTTTTGCA
GATAACAATATTGCTTTTTTTCTCTGACT
  Box motif
  Complementary to target RNA
length 88
organism Saccharomyces_cerevisiae
snoRNA name snR56
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:0:snR56
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:G1428
accession no AF064268,BK006936
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved