snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR50
sequence
TTAGAATGATGAAAGAGGTAGCAATTTGCAGCAGATTTTTCGTGATTGAATCAAACAAA
GATTAACCTTTACAGAACCGCTACACTGATA
  Box motif
  Complementary to target RNA
length 90
organism Saccharomyces_cerevisiae
snoRNA name snR50
alias Z14
chromosome ⁄ contig XV
locus ⁄ host gene Mono:39:snR50
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:G867
accession no AF064262,BK006948
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved