snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR30
sequence
AACCATAGTCTCGTGCTAGTTCGGTACTATACAGGGAAGGGAAGTCACTCGCATACGTG
TGTGTGCATTTCTTGCTATTGCTGCTTAGCTTCTCTAAAACACTGGGCTAGCGTTTTTCA
ACGCTCGAGAGGCAGAGTCTCAAGGAGCCTCCAATGGGCCTCACGTATTCATCTAGATGG
CGCTTCGGACAACGGCATCACATAAGAGATGCAGCTCCTGACTTCTCCTCTGATCTTCGT
GATCAGAGTTTTGAGTCGTCAGACTACGAGCAGTTTCTCTTAGTCGTTGCATCGGGTGCT
GTTGCCTTAACGATGTGTATATGGGGTTCGGGGGCTGTTGCCATGATATATATGGATGAG
ACAGAAGTGGCCCCGTTGACGAGTTTAACTTAGATTAAGTAGGACGCATGATCTTGAGCT
CTTTTCCTATACTTTGTCCTATGGCCAGCTTTCTCCTTATTACGAAGAGATTGCGGGATG
TGGGTGCAGAGTGGGAAAATCTGAGTTCGGTCATCTTTGTTGTTCGTCCTACCGCAGTAT
ATTCCTAAACACTATGAAATGACCCTAGTTGGTCCATGATCATTTGGGTAAAACCATACT
GCAGACATCT
  Box motif
  Complementary to target RNA
length 609
organism Saccharomyces_cerevisiae
snoRNA name snR30
alias U17
chromosome ⁄ contig XII
locus ⁄ host gene Mono:28:snR30
organization Mono
target RNA Unknown
modification type H/ACA
modification site Processing
accession no BK006945,X07673
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved